How to Wrap Long Strings in HTML and XUL?

Wrapping Long Strings in HTML and XUL

For situations where you have a lengthy string lacking any whitespace, such as a DNA sequence, it can be necessary to wrap the text to improve readability. Here's how you can force wrapping in HTML and XUL:

HTML:

To wrap a string in an HTML textarea, use the word-wrap CSS property with the break-word value. This setting breaks the string at word boundaries, ensuring a clean wrap.

<textarea>

XUL:

For XUL textboxes, set the overflow and wrap attributes as shown below. overflow allows the text to extend beyond the textbox height, while wrap forces it to break into multiple lines when necessary.

<xul:textbox overflow="auto" wrap="true">
  ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTC
</xul:textbox>

The above is the detailed content of How to Wrap Long Strings in HTML and XUL?. For more information, please follow other related articles on the PHP Chinese website!